Convert newline formated sequence into fasta format with perl
use strict; use warnings; my $filename = $ARGV[0]; open(my $fh, '2370 days ago
Extract fasta sequence with Ids with Bash script
#!/bin/bash while IFS='' read -r line || [[ -n "$line" ]]; do echo "Text read from file: $line" samtools faidx ONT.fasta $line > $line.faa done < "$1"2354 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://ww...tx', 'BlastTargetSet' => 'ATH1_pep', 'QueryText' => $sequence,...2325 days ago
Insert the sequence at desire location in multi-fasta file with Perl
#!/usr/bin/perl use warnings; use strict; use Bio::SeqIO; use Bio::Seq; use File::Copy; #ARGV[0] should be in following format --- Keep the coordinate sorted b...2314 days ago
Create genome scaffolding with Perl
...); # process remaining command line arguments (hopefully only PSL...essage => "Error: Unknown command-line option or ". "n...print(STDERR "Loading query sequences into memory..."); open(my $...e is assumed to be forward strand $lSeq = rc($lSeq);...2309 days ago
Perl script to convert fastq to fasta file
#!/usr/bin/env perl use strict; use warnings; use Bio::Factory::EMBOSS; my $usage = "perl $0 in.fq out.fa"...); # $seqret is a Bio::Tools::Run::EMBOSSApplication object $seqret->run({-sequence...2251 days ago
Plot custom gene density with R
library(karyoploteR) pp2250 days ago
Perl script to read multi fasta sequence one by one
#!/usr/bin/env perl use strict; use warnings; #USAGE #perl rohanRun.pl seq.fa m...} sub readfasta { (my $file)=@_; my %sequence; my $header; my $temp_seq; #suppose fasta files contains multiple sequences...2221 days ago
Perl script to find coding regions in DNA sequences
...dontable = $ARGV[0]; my $filesequence = $ARGV[1]; # open the f...ession # A group of letters and a decimal number ($codon,$fre...############# # open the DNA sequence (second file) if (!open(SE...he codons in # the input DNA sequence. To split the sequence in seg...2155 days ago
Biological Sequence handling with Perl !
package Sequence::Generic; # File: Sequence/Generic.pm use strict; us...} # Return the type of the sequence as a human readable string s...dues)'; } # Concatenate two sequences together and return the result sub concatena...lass) if ref($class); my ($sequence,$type) = @_; my $self =...2181 days ago