Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; pri...the DNA (see why we saved the original?) $revcom = reverse $DNA; # See the text f...2057 days ago
2032 days ago
2018 days ago
Installing ggplot2 and its dependencies on Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads/MitoHunter/minidot/bin$ sudo R [sudo] password for jit: R version 3.4....-Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -g -c context.c -o context.o...1564 days ago
Pack a perl program with their dependencies on Ubuntu !
#Follow steps to create your own executable ./web jit@jit-HP-Pro-3335-MT:~/Downloads/autoConTAMPR/bin$ sudo apt...(function() { var ga = document.createElement('script'); ga.type = 'text/j...1525 days ago
1229 days ago
1229 days ago
Set up WGD environment using conda !
#Wgd cannot be installed directly with bioconda at present, so it is slightly troublesome to install, because it #...-v, --verbosity [info|debug] Verbosity level, default = info. -l, --logfile TEXT...1217 days ago
Commands to Remove White Space In Text Or String Using Awk And Sed In Linux
text=" ATGGTV AGTGACCTAGAGTGATGA G GGRTTT" echo "$text" | sed 's/ //g' OR echo "$text" | awk '{ gsub(/ /,""); print }' Return: ATGGTVAGTGACCTAGAGTGATGAGGGRTTT echo "$text"...970 days ago
909 days ago