2196 days ago
Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-Wu...2957 days ago
Install ATOM editor on Elemantory OS / Ubuntu
#Download ATOM deb file from https://atom.io/ https://atom.io/download/deb (base)...But did you know that you can turn Atom into a full-fledged IDE (integrated development environment) like Eclipse, Py...1227 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::D...ally written by Abigail # Documentation for the algorithm is at # http://theoryx5.uwin...=> 0, fitness => 0 }; } } __DATA__ about algorithm...2423 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAG...last/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm'...2377 days ago
2127 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print...complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorithm,...2095 days ago
2071 days ago
1267 days ago
Tadpole is 250x faster than SPADes assembler !
lege@jit-Lenovo-ideapad-320-15ISK:~/Downloads/MyTools/Vir$ tadpole.sh Written by Brian Bushnell.... reassemble=t If ecc is enabled, use the reassemble algorithm. pincer=f If ecc is enabled, use the pincer algorithm....1028 days ago