Compress and decompress the sequence with perl
use strict; use warnings; my @char; while () { @char = split //; } comp(\@char); #--------------------- my $com= "r0a3m4a4j0"; my @com = split //, $com; dcomp (\@com); #dcomp sub here sub dcomp { my ($com_ref)=@_; my @com=@$com_ref; my $car; for (my $aa=0; $aa2566 days ago
Extract fasta sequence with Ids with Bash script
#!/bin/bash while IFS='' read -r line || [[ -n "$line" ]]; do echo "Text read from file: $line" samtools faidx ONT.fasta $line > $line.faa done < "$1"2406 days ago
Clump Finding Problem Solved with Perl
...use strict; use warnings; my %myHash; my $string="CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGAAGAGAAGAGGAAA...sliding window my ($string, $myStr, $kmer)=@_; my $count=0; for (my $aa=0; $aa...2385 days ago
Create genome scaffolding with Perl
...b); } sub rc { my ($seq) = @_; $seq =~ tr/ACGTUYRSWMKDVHBXN-/TGCAARYSWKMHBDVXN-/; # work on masked sequences as well $seq =~ tr/acgtuyrswmkdvhbxn/tgcaaryswkmhbdvxn/; return(scala...2360 days ago
Extract the values between to user defined string with Perl
...END START New line And new Will be extracted? END XXX ZZZ YYY START These are the second set of lines which are to be extracted END aasds tteret tertetr2344 days ago
Plot custom gene density with R
library(karyoploteR) pp2301 days ago
Perl script to find palindromic regions in DNA sequences
use strict; use warnings; my $pp = qr/(?: (\w) (?1) \g{-1} | \w? )/ix; my $filename = $ARGV[0]; open(my $fh, '2206 days ago
Biological Sequence handling with Perl !
...'F',UUC => 'F',UUA => 'L',UUG => 'L', UAU => 'Y',UAC => 'Y',UAA => '*',UAG => '*',...'P',CCG => 'P',CCC => 'P',CCU => 'P', CAU => 'H',CAC => 'H',CAA => 'Q',CAG => 'Q',...2232 days ago
Perl script to find coding regions in DNA sequences
...en negative) for intronic regions. exon.fa >HUMHBB.2ex GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACT CCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGG...2206 days ago
2189 days ago