Results for "GA"
Bio-Scripts
bash script to extract sequence by ids !
...1 TTCAAGTGTTAGTTTCACATCAT >BGI_novel_T018109 Solyc03g080075.1.1 GCAAGGGAAAGAAGTATTACTAG >BGI_novel_T01681...cat out.fasta Output: >BGI_novel_T016697 Solyc03g033550.3.1 CTGACGTATACAATTAAGCCGCG >BGI_nove...882 days ago
- #GATK is a toolkit developed by the br...se. First let’s download and unzip GATK from github. The creators of GATK recommend running GATK thro...o create a virtual environment for GATK by using the yaml file incl...https://github.com/broadinstitute/gatk/releases/download/4.0.2.1/g...
870 days ago
- ...| h7b6447c_0 2.6 MB gawk-5.1.0 |...be SUPERSEDED by a higher-priority channel: gawk conda-for...####################################### | 100% gawk-5.1.0 | 1007 KB...
844 days ago
Conda command to install checkV
...h166bdaf_0 2.1 MB conda-forge prodigal-gv-2.9.0 | h7...arch::more-itertools-8.13.0-pyhd8ed1ab_0 prodigal-gv bioconda/linux-64:...################################## | 100% prodigal-gv-2.9.0 | 916 KB | ##...694 days ago
Script to rapid genome clustering based on pairwise ANI
First, create a blast+ database: makeblastdb -in -dbtype nucl -out Next, use megablast from blast+ package to perform all-vs-all blastn of sequences: blastn -query -db -outfm...694 days ago
Genome Scaffolding and gap filling !
scaffolding with ARCS v1.0.3 (−c3, −l,4, −a,0.9, −z500, −m50, −20 000, −e30000, −s90). https://github.com/bcgsc/arcs Next, automated gap filling was performed using Sealer v2.0.1 (−L150, -P10, −k75-115 [step = 10]) https://github.com/bcgsc/abyss/tree/sealer-release679 days ago
Identify genome-wide synteny with LASTZ alignment
...gnment using LASTZ and Chain/Net lastz AAChr1.txt FFChr1.txt K=2200 L=6000 Y=3400 E=30 H=0 O=400 T=1 --format=axt --out=chr01.axt axtChain -linearGap=medium chr01.axt AAChr1.txt...576 days ago
Perl script to find edit distance between two sequences !
#!/usr/bin/perl use strict; use warnings; sub edit_distance { my ($s1, $s2) = @_; my $len1 = length($s1); my $len2 = length($s2); my @dp; for (my $i = 0; $i483 days ago
Raku script to find palindrome in genomes !
...bstring) { say "Palindrome found at position $pos: $substring"; } } } } # Example usage my $dna = "GGATCCATGGCCTAGG"; # example DNA...483 days ago
Perl script for chi-squared test !
...nings; use Getopt::Long; use FAlite; # sanity checks die "Usage: chidi.pl \n" if (!$ARGV[1]); my @dinucs = qw (AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT); # h...470 days ago
