Results for "Algorithm Analysis"
Bio-Scripts
Blast result parser with Perl and Bioperl
#!/usr/local/bin/perl # # Dr. Xiaodong Bai # It may be freely distributed under GN...ated and ready for import into a spreadsheet program for browsing and further analysis. # use strict; use warni...2912 days ago
Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-W...2903 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::D...ally written by Abigail # Documentation for the algorithm is at # http://theoryx5.uwin...=> 0, fitness => 0 }; } } __DATA__ about algorith...2369 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGA...Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorith...2322 days ago
Perl script to run SATSUMA in loop !
#!/usr/bin/perl -w use strict; use File::Temp qw(tempfile); # Usage perl 1by1.pl for SATSUMA analysis # User need to set the ref...2137 days ago
Install Parrot Virtual Machine !
#Parrot is a virtual machine designed to efficiently compile and execute bytecode for d...alled.................................no. auto::coverage - Are coverage analysis tools installed...Negative re...1534 days ago
- ➜ BorisTrinityAssembly /home/urbe/Tools/transrate-1.0.3-linux-x86_64/transrate...mbly/transrateSTAT/Trinity/contigs.csv [ INFO] 2018-07-13 14:54:40 : Writing analysis results to assemblies.csv
2120 days ago
- ...-11e8-8de3-124a69f123c8?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Creden...-11e8-8de3-124a69f123c8?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Creden...ics for the given BaseCalling analysis directory. ExtractIllu...ools that perform metagenomic analysis, e.g. microbial community com...
2072 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print...e complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorith...2040 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail ---------------------...ssibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...ssibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...2031 days ago
