Results for "Algorithm Development"
Bio-Scripts
# To follow these instructions, we'll assume your system admins have already installed...xml2-dev # RHEL/CentOS system admins should run: sudo yum groupinstall -y 'Development Tools' sudo yum install -y e...2157 days ago
Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-Wu...2919 days ago
Install ATOM editor on Elemantory OS / Ubuntu
#Download ATOM deb file from https://atom.io/ https://atom.io/download/deb (base)...But did you know that you can turn Atom into a full-fledged IDE (integrated development environment) like Eclipse, Py...1189 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::D...ally written by Abigail # Documentation for the algorithm is at # http://theoryx5.uwin...=> 0, fitness => 0 }; } } __DATA__ about algorithm...2385 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAG...last/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm'...2338 days ago
- jitendra@jitendra-UNLOCK-INSTALL[SNP] wget https://github.com/broadinstitute/gatk/release...452807/b52ea0c4-1e27-11e8-8de3-124a69f123c8?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Creden...452807/b52ea0c4-1e27-11e8-8de3-124a69f123c8?X-Amz-Algorithm=A...
2088 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print...complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorithm,...2056 days ago
- ➜ Tools git:(master) ✗ wget https://github.com/samtools/htslib/releases/download/1.9/hts...339773/f2f10d8a-8a73-11e8-89f4-07e1d9d77b17?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Creden...339773/f2f10d8a-8a73-11e8-89f4-07e1d9d77b17?X-Amz-Algorithm=A...
2032 days ago
- (JitMetaENV) ➜ assembly conda install -c bioconda prokka Collecting package metadata (current_repodata.json): done Solving environment: failed with initial frozen solv...
1228 days ago
Tadpole is 250x faster than SPADes assembler !
lege@jit-Lenovo-ideapad-320-15ISK:~/Downloads/MyTools/Vir$ tadpole.sh Written by Brian Bushnell.... reassemble=t If ecc is enabled, use the reassemble algorithm. pincer=f If ecc is enabled, use the pincer algorithm....989 days ago
