Install BLAST in Ubuntu/Linux and Window !
#On ubuntu sudo apt-get install ncbi-blast+ #Ubuntu Conda installation conda...d ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi-blast-2.7.1+-win64...http://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi-blast-2.7.1+-win64...1147 days ago
Blast result parser with Perl and Bioperl
#!/usr/local/bin/perl # # Dr. Xiaodong Bai # It may be freely distributed under GNU General Public License. # This script will parse a NCBI blastx output file and...2914 days ago
Blast script to index and extract sequence !!
# look at the file $ head EC4115.fa >NC_011353.1 Escherichia coli O157:H7 str. EC4115 chromosome, complete genome. AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAA...2852 days ago
BASH script for SelfBLAST a genome
#!/bin/bash #self BLAST a genome -- Expecting you have blast and samtools installed in your system #Author: Jitendra Narayan #USAGE: ./selfBlast.sh extract #USAG...2652 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabido...2325 days ago
Installing Busco version 4.0.6
(base) jit@jit-HP-Pro-3335-MT: conda install -c bioconda -c conda-forge busco=4.0.6 Collecting package metadata (repodata.json): done Solving environment: done ##...1453 days ago
Installing pb-assembly on Linux !
...libxslt/1.1.28-foss-2016a blas/gcc/3.2.1 libXt/1.1.5-foss-2016a BLAST+/2.3.0-foss-2016a-Python-2.7.1...2034 days ago
1762 days ago
1215 days ago
Set up WGD environment using conda !
#Wgd cannot be installed directly with bioconda at present, so it is slightly troublesome to install, because it #depends on a lot of software. wgd depends on the follo...1203 days ago