Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-W...2916 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512...ally written by Abigail # Documentation for the algorithm is at # http://theoryx5.uwin...=> 0, fitness => 0 }; } } __DATA__ about algorithm and biology by century c...2382 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my...Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm' => 'blastx', 'BlastTarg...2336 days ago
2086 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is th...e complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorithm, and the reverse complement w...2054 days ago
2030 days ago
1226 days ago
Tadpole is 250x faster than SPADes assembler !
lege@jit-Lenovo-ideapad-320-15ISK:~/Downloads/MyTools/Vir$ tadpole.sh.... reassemble=t If ecc is enabled, use the reassemble algorithm. pincer=f If ecc is enabled, use the pincer algorithm. tail=f If ecc...987 days ago
Perl script for Smith-Waterman Algorithm
# Smith-Waterman Algorithm # usage statement die "usage: $0 \n" unless @ARGV == 2; # get sequences from command line my ($seq1, $seq2) = @ARGV; # scoring scheme my...961 days ago
961 days ago