2062 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';...print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s/A/T/g; $rev..."Here is the reverse complement DNA: WRONG:\n\n"; print "$revc..."Here is the reverse complement DNA:\n\n";...2045 days ago
Bash script to download SRA file !
#We can use the sratoolkit to directly pull the sequence data (in paired FASTQ for...p is in the SRA toolkit. It allows directly downloading data from a particular sequencing run ID fastq-dump --split-...1561 days ago
To convert just one specific read group to fastq
# Stop script on error. set -uex # The SRR BioProject number for the sequencing data. PROJECT=PRJNA257197 # The...1544 days ago
Pack a perl program with their dependencies on Ubuntu !
#Follow steps to create your own executable ./web j...A is a method for detecting structural variants in sequencing data using genome-wide local...ansfer (HGcoT) between bacteria using whole-genome sequencing (WGS) data. It is particularl...1513 days ago
Perl One-Liner to print only non-uppercase letters
#Go through file and only print words that do not have any uppercase letters. perl -ne 'print unless m/[A-Z]/' dna.fa > dnaOnlyLowercase.fa #To lowercase everything perl -pne 'tr/[A-Z]/[a-z]/' dnaUpperCase.fa >dnawithoutuppercase.fa;1385 days ago
1342 days ago
1217 days ago
Commandline for paired end reads simulation with BBMap !
(JitMetaENV) ➜ mixedSample git:(main) ✗ /home/urbe/Tools/bbmap/randomreads.sh ref=mixed.fa out=reads_BBMAP250.f...=250, mininsert=400, maxinsert=600, gaussian] Writing reference. Executing dna.FastaT...991 days ago
Install Varscan on Ubuntu / Linux !
#Varscan is a java program designed to call variants in sequencing data. It was developed at the Genome Institute at Washington University and is hosted on github. To use Varscan we simply need to d...825 days ago