List of gene ontology software and tools
...wsing of GO graph structure, interactive visualisation of retrieved results, and many other features. Multiple testing corrections are applied to extract only statistically important...3711 days ago
BBTools for bioinformatician !
...ate everything after the first whitespace. Extract reads from a sam file &nbs...n disable that with "rcomp=f". Extract sequences that share kmers wi...0) then you can use the following command to extract those reads in a new file....2272 days ago
Download mutliple fasta file from NCBI in one GO!!
if you have less time, then use three ways mentioned in bookmark link to extract/download all fasta sequences in single click given that you already have a list of GIs or accession ID...3912 days ago
RNA-Seq De novo Assembly Using Trinity
...al de Bruijn graphs, each representing the transcriptional complexity at at a given gene or locus, and then processes each graph independently to extract full-length splicing isoforms...2967 days ago
3616 days ago
Awesome perl frameworks, libraries and software - PART 2
...dcom.pm - Gedcom - a Perl module to manipulate Gedcom genealogy files mj41/auto-unrar - Smart Perl scripts (for Linux) to auto unrar / extract a directory structure contain...2496 days ago
3949 days ago
Most Commonly used Awk by Bioinformatician
...cover most of bioinformatician daily uses of awk. choose rows where column 3 is larger than column 5: awk '$3>$5' input.txt > output.txt extract column 2,4,5: awk '{print $2...3914 days ago
3415 days ago
2998 days ago
3418 days ago
2146 days ago
2919 days ago
Extract the numeric values from the multiple FASTA sequence file.
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...Tags: Extract, Number, Fasta, Coordinates
3649 days ago
Comment on "Far Manager Commands and Links !"
...enu by holding down the button Shift, which is mainly intended for working with files and archives, namely: F1- add files to archive F2- extract files from archive F3- execu...942 days ago
Comment on "Far Manager Commands and Links !"
...rEng.hlf is a simple text file, you can open it in any editor. ShiftF1 Create new archive from selected files ShiftF2 Extract files from selected archive...963 days ago