Perl script to break the contigs by 'N'
#!/usr/bin/perl -w use Bio::SeqIO; use strict; my $fasta =...>$ARGV[0].parts.scaff"); while ( my $seqobj = $fasta->next_seq() ) { #gets contig id my $contig = $seqobj->display_id(); #gets contig sequence...2084 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2064 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2064 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail ---------------------...ossibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...ossibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...2055 days ago
Setting up falconUnzip conda environments for genome assembly !
...$ conda deactivate ➜ Analysis_Results source activate denovo_asm (denovo_asm) ➜ Analysis_Results conda install pb-asse...e currently available SMRT(R) Analysis builds. While # # efforts ha...e currently available SMRT(R) Analysis builds. While # # efforts ha...2011 days ago
Finding Kmers from fasta sequence file
Save it in sample.fa >test TAATGCCATGGGATGTT jellyfish count -m 3 -s 100000 sample.fa -o sample.jf jellyfish dump -c sample.jf It return TGT 1 GAT 1 GGG 1 GGA 1 CAT 1 TGC 1 TAA 1 GCC 1 CCA 1 GTT 1 TGG 1 ATG 3 AAT 11993 days ago
Perl script to split fasta sequence and create overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "1993 days ago
Perl script to run in parellel !
...les($ARGV[0]); my %genome=%{$sequence_data_ref}; my $n_processes...esses ) { $pm->start and next; my $count = 0; forea...my $file=shift; my (%sequence_data); my $file_content...y $gene_info = $file_content->next_seq()) { my $sequence = $g...1707 days ago
Perl subroutine to creating kmer !
sub k_mers { my ($sequence, $k) = @_; my $len = length($sequence); my @result = (); for (my $i = 0; $i1588 days ago
Bash script to download SRA file !
#We can use the sratoolkit to directly pull the sequence data (in paired FASTQ format) from the archive. fastq-dump is in the SRA toolkit. It allows directly downloading data fro...1580 days ago