Install BLAST in Ubuntu/Linux and Window !
#On ubuntu sudo apt-get install ncbi-blast+ #Ubuntu Conda installation conda install -c bioconda blast #Windows installation Fir...wnload ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi...stead http://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi...1140 days ago
Blast result parser with Perl and Bioperl
#!/usr/local/bin/perl # # Dr. Xiaodong Bai...c License. # This script will parse a NCBI blastx output file and output the top N hits of each blast search result. # For each hi...Hits,$outfile) = @ARGV; print "Parsing the BLAST result ..."; my $in = Bio::S...2908 days ago
Blast script to index and extract sequence !!
# look at the file $ head EC4115.fa >NC_011353.1...GCGCACAGACAGATAAAAATTACAGAGTAC # generate the blast database $ makeblastdb -dbtype nucl -out EC -in EC...TAACCAATATAGGCATAGCGCACAGAC .... # query the blast database by id and coordinate...2845 days ago
BASH script for SelfBLAST a genome
#!/bin/bash #self BLAST a genome -- Expecting you have blast and samtools installed in your...itendra Narayan #USAGE: ./selfBlast.sh extract #USAGE: ./selfBl...-f $MYDB.nhr ] then echo "BLAST database for MergedContigs.fa...o "You want entire sequence to blast" SEQ=$FASTAFILE else e...2645 days ago
Fill up the form and blast with perl
...'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm' => 'blastx', 'BlastTargetSet' => '...2319 days ago
Installing Busco version 4.0.6
...0 2.6 MB conda-forge blast-2.2.31 |...199 KB conda-forge r-ellipsis-0.3.0 | r36hcdc...::biopython-1.76-py37h516909a_0 blast bioconda/linux-6...gest-0.6.25-r36h0357c0b_2 r-ellipsis conda-forge/linux-64::...1446 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail ---------------------------------------------...libXt/1.1.5-foss-2016a BLAST+/2.3.0-foss-2016a-Python-2.7....2028 days ago
1755 days ago
1209 days ago
Set up WGD environment using conda !
#Wgd cannot be installed directly with bio...depends on the following software #BLAST #MCL #MUSCLE/MAFFT/PRANK #...aster) conda create -n wgd python=3.7 blast mcl muscle mafft prank paml...Commands: dmd All-vs.-all diamond blastp + MCL clustering. kde Fi...1197 days ago