Results for "coalescence time"
Bio-Scripts
# To follow these instructions, we'll assume your system admin...Archive::Extract Archive::Tar Archive::Zip CGI DBI Time::HiRes DBD::mysql Encode File...::Log4perl FindBin::Real Getopt::Long Catalyst::Runtime Catalyst::Devel List::Util Te...2155 days ago
Implementation of biological random mutation with Perl
#!/usr/bin/perl -w use strict; use warnings; #sequence for a better recognitio...AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ n"; my $I; my $mutant; srand (time | $$). $mutant=mutate ($DN...2912 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::Dumper; # individuals in the population my $popsize = 1024; # a good...2382 days ago
- ➜ upgrade_oh_my_zsh Updating Oh My Zsh remote: Counting objects: 484, done. remote: Co...hemes/duellj.zsh-theme | 2 +- themes/fino-time.zsh-theme...
2085 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the s...e is the reverse complement DNA:\n\n"; print "$revcom\n"; print "\nThis time it worked!\n\n"; exit;2054 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail ------------------------...cc-ng-7.2. 100% |################################| Time: 0:00:01 5.16 MB/s perl-5.26.2-h4 100% |################################| Time: 0:00:00 17.85 MB/s zlib-1....2045 days ago
- (denovo_asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001/git-sym.git f...00k-sv2.2.tar | tar xvf - % Total % Received % Xferd Average Speed Time Time Time Current...
2045 days ago
Setting up falconUnzip conda environments for genome assembly !
➜ Analysis_Results conda create -n denovo_asm Solving enviro..., # # to any extent or within any time frame...., # # to any extent or within any time frame....2000 days ago
Bash commandline to install Anaconda !
#The line begins with $ are the commands $ mkdir tmp $ cd tmp/ $ curl -O https:...2019.03-Linux-x86_64.sh % Total % Received % Xferd Average Speed Time Time Time Current...1566 days ago
Installing ggplot2 and its dependencies on Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads/MitoHu...Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -g -c gl...Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -g -c in...Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -g -c str...Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -g -c str...1560 days ago
