Results for "convert"
Blogs
BBTools for bioinformatician !
...Code: ACCGTTACCGTTACCGTTAC 100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be pretty obvious. Convert SAM format from 1.4 to 1.3 (r...2265 days ago
- ...s to the same reference build. LiftOver can have three use cases: (1) Convert genome position from one geno...C hg 18) and hope to lift them over to NCBI build 37 (UCSC hg19). (2) Convert dbSNP rs number from one buil...
2155 days ago
- +2 more Blogs
Bookmarks
- ...enome coordinates between assemblies. It’s not a program for aligning sequences to reference genome. We do not recommend using CrossMap to convert genome coordinates between sp...
3003 days ago
- ...ows platforms. Currently CSBB provides 13 modules focused on analytical tasks like performing upper-quantile normalization on expression data or convert genome wide gene expression t...
2862 days ago
- +13 more Bookmarks
Files
- ...429.488 sec[E::hts_open_format] Failed to open file temporarySamsamtools sort: can't open "temporarySam": No such file or directory[bwa_aln_core] convert to sequence coordinate... 1.0...
2146 days ago
Pages
Bio++ : C Language libraries for your biological need
...as possible, and retain its spirit and efficiency. It was possible to convert from C to C++ gradually, thus...d names, testing existence, open and store in string arrays, etc.Text: convert text to any other type and vi...3942 days ago
Genome Assembly Tools and Software - PART2 !!
...p Assembly problemATLAS GapFill deals with the repetitive gap assembly problem by using the unique gap-flanking sequences to group reads and convert the problem to a local assemb...2680 days ago
- +3 more Pages
Top-level pages
Perl one-liner for bioinformatician !!!
...spacing, numbering lines, doing calculations, converting and substituting text, del...00, 105, 110, 103); print pack("C*", @ascii)'#converts ascii values into character...)/\u$1/g' #Camel Casingperl -pe 's|\n|\r\n|' #Convert unix new lines into DOS new l...3623 days ago
- ...ckage. It is a multipurpose tool designed for converting reads or other nucleotide...different formats. It supports, and can inter-convert: fastq fasta fasta+qual sam...namimg conventions: reformat.sh in=x.fq vint Convert ASCII-33 to ASCII-64: reforma...
2709 days ago
- +8 more Top-level pages
Wire posts
Opportunity posts
SRF/JRF Bioinformatics at CIARI
...ands. The ultimate aim of CIARI is the developments of island agricultural production technologies which utilizes the strengths of the island and convert the constraints in opportunit...3070 days ago
Video
Translational Bioinformatics: Transforming 300 Billion Points of Data
...well described. The nascent field of translational bioinformatics may help. Dr. Butte's lab at Stanford University builds and applies tools that convert more than 300 billion points...3905 days ago
Bio-Scripts
BioPerl to convert between sequence formats from Fasta to Genbank
#!/usr/local/bin/perl -w # Sequence formats to choose: Fasta, EMBL. GenBank, Swissprot, PIR and GCG use Bio::SeqIO; $inFile = "BRCA2.fa"; $in = Bio::SeqIO-...2911 days ago
Convert newline formated sequence into fasta format with perl
use strict; use warnings; my $filename = $ARGV[0]; open(my $fh, '2365 days ago
- +24 more Bio-Scripts
Tags
Converting BLAST output into CSV
Suppose we wanted to do something with all this BLAST output. Generally, that’s the case - you want to retrieve all matches, or do a reciprocal BLAST, or something. As with most programs that run on UNIX, the text output is in some specific format. If the program is popular enough, there w...Tags: Convert, BLAST, output, CSV, blastn, megablast
2332 days ago
Convert VCF to tab-deilimited table
Performed with GATK : java -Xmx8g -jar GenomeAnalysisTK.jar \ -T VariantsToTable \ -R reference.fa \ -V reference_genomes_GT.vcf \ -F CHROM -F POS -F REF -F ALT -GF GT \ -o reference_genomes_GT.table multiple_sample.vcf should also be converted to multiple_sample_GT.table using this...Tags: Convert, VCF, tab-deilimited, table
2177 days ago
- +1 more Tags
Comments
Comment on "Tools for Sequence translation !"
Sequence translation is the process of converting a DNA or RNA sequence into its corresp...several genetic codes and can also perform reverse translation (i.e., convert a protein sequence into its c...416 days ago
Comment on "Run miniasm assembler on nanopore reads !"
...\ /home/data/20170911_oly_pacbio_cat.fastq /home/data/20170911_minimap2_pacbio_oly.paf > /home/data/20170918_oly_pacbio_miniasm_reads.gfa 3 Convert miniasm output GFA to FASTA...2162 days ago
- +3 more Comments
