Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.






All Site Activity

  • REViGO can take long lists of Gene Ontology terms and summarize them by removing redundant GO terms. The remaining terms can be visualized in semantic similarity-based scatterplots, interactive graphs, or tag clouds. More about...
  • Filtering on quality and/or read length, and optional trimming after passing filters.Reads from stdin, writes to stdout. Intended to be used: directly after fastq extraction prior to mapping in a stream between extraction and...
  • Jit commented on the bio-script Installing Porechop on Ubuntu ! 2928 days ago
    ➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa Loading reads/media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta1,634,477 reads loaded Looking for known adapter sets10,000 / 10,000...
  • Jit created a new bio-script Installing Porechop on Ubuntu ! 2928 days ago
    Comments
    • Jit 2928 days ago

      ➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa

      Loading reads
      /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta
      1,634,477 reads loaded


      Looking for known adapter sets
      10,000 / 10,000 (100.0%)
      Best
      read Best
      start read end
      Set %ID %ID
      SQK-NSK007 96.6 81.8
      Rapid 66.1 0.0
      SQK-MAP006 80.0 82.6
      SQK-MAP006 Short 76.9 76.0
      PCR adapters 1 82.6 78.3
      PCR tail 1 76.7 75.9
      PCR tail 2 79.3 77.4
      1D^2 part 1 74.1 76.7
      1D^2 part 2 91.2 80.6
      Barcode 1 (reverse) 76.0 78.6
      Barcode 2 (reverse) 79.2 80.0
      Barcode 3 (reverse) 80.0 75.0
      Barcode 4 (reverse) 80.0 77.8
      Barcode 5 (reverse) 73.1 76.9
      Barcode 6 (reverse) 76.0 76.9
      Barcode 7 (reverse) 79.2 79.2
      Barcode 8 (reverse) 81.5 76.0
      Barcode 9 (reverse) 76.0 76.0
      Barcode 10 (reverse) 76.0 78.6
      Barcode 11 (reverse) 79.2 80.8
      Barcode 12 (reverse) 80.0 83.3
      Barcode 1 (forward) 83.3 80.0
      Barcode 2 (forward) 80.0 80.0
      Barcode 3 (forward) 76.9 76.0
      Barcode 4 (forward) 80.8 76.9
      Barcode 5 (forward) 75.0 75.0
      Barcode 6 (forward) 76.9 76.9
      Barcode 7 (forward) 80.0 79.2
      Barcode 8 (forward) 76.9 76.9
      Barcode 9 (forward) 80.0 76.9
      Barcode 10 (forward) 77.8 79.2
      Barcode 11 (forward) 76.9 80.0
      Barcode 12 (forward) 79.2 79.2
      Barcode 13 (forward) 76.9 80.0
      Barcode 14 (forward) 76.0 74.1
      Barcode 15 (forward) 73.1 75.0
      Barcode 16 (forward) 76.0 79.2
      Barcode 17 (forward) 76.0 75.0
      Barcode 18 (forward) 76.9 78.6
      Barcode 19 (forward) 78.6 80.8
      Barcode 20 (forward) 80.0 79.2
      Barcode 21 (forward) 79.2 80.0
      Barcode 22 (forward) 79.2 80.0
      Barcode 23 (forward) 75.0 75.0
      Barcode 24 (forward) 80.8 76.0
      Barcode 25 (forward) 76.9 77.8
      Barcode 26 (forward) 80.0 77.8
      Barcode 27 (forward) 76.0 76.9
      Barcode 28 (forward) 80.0 77.8
      Barcode 29 (forward) 76.0 76.0
      Barcode 30 (forward) 80.0 76.9
      Barcode 31 (forward) 79.2 77.8
      Barcode 32 (forward) 76.0 79.2
      Barcode 33 (forward) 76.9 76.0
      Barcode 34 (forward) 76.0 79.2
      Barcode 35 (forward) 76.0 75.0
      Barcode 36 (forward) 76.0 76.0
      Barcode 37 (forward) 80.0 80.0
      Barcode 38 (forward) 76.0 80.8
      Barcode 39 (forward) 74.1 76.0
      Barcode 40 (forward) 79.2 76.0
      Barcode 41 (forward) 76.0 77.8
      Barcode 42 (forward) 76.0 80.0
      Barcode 43 (forward) 76.9 79.2
      Barcode 44 (forward) 76.0 75.0
      Barcode 45 (forward) 76.0 76.9
      Barcode 46 (forward) 79.2 76.0
      Barcode 47 (forward) 76.0 75.0
      Barcode 48 (forward) 79.2 76.0
      Barcode 49 (forward) 80.8 78.6
      Barcode 50 (forward) 75.0 76.9
      Barcode 51 (forward) 76.0 76.0
      Barcode 52 (forward) 76.9 79.2
      Barcode 53 (forward) 76.0 76.9
      Barcode 54 (forward) 76.9 80.0
      Barcode 55 (forward) 79.2 77.8
      Barcode 56 (forward) 80.0 76.0
      Barcode 57 (forward) 75.0 76.0
      Barcode 58 (forward) 75.0 75.0
      Barcode 59 (forward) 76.9 79.2
      Barcode 60 (forward) 75.0 76.9
      Barcode 61 (forward) 73.1 76.0
      Barcode 62 (forward) 76.9 76.0
      Barcode 63 (forward) 76.0 77.8
      Barcode 64 (forward) 81.5 79.2
      Barcode 65 (forward) 76.0 76.9
      Barcode 66 (forward) 76.0 76.9
      Barcode 67 (forward) 76.9 76.9
      Barcode 68 (forward) 79.2 79.2
      Barcode 69 (forward) 76.9 76.9
      Barcode 70 (forward) 76.9 76.0
      Barcode 71 (forward) 77.8 76.0
      Barcode 72 (forward) 80.0 76.0
      Barcode 73 (forward) 79.2 80.0
      Barcode 74 (forward) 77.8 76.9
      Barcode 75 (forward) 79.2 76.0
      Barcode 76 (forward) 80.0 79.2
      Barcode 77 (forward) 76.0 76.0
      Barcode 78 (forward) 80.0 80.8
      Barcode 79 (forward) 76.9 80.0
      Barcode 80 (forward) 76.9 76.9
      Barcode 81 (forward) 77.8 80.0
      Barcode 82 (forward) 77.8 75.0
      Barcode 83 (forward) 77.8 80.0
      Barcode 84 (forward) 75.0 75.0
      Barcode 85 (forward) 76.9 76.9
      Barcode 86 (forward) 76.0 76.0
      Barcode 87 (forward) 76.0 76.9
      Barcode 88 (forward) 80.8 76.0
      Barcode 89 (forward) 79.2 80.0
      Barcode 90 (forward) 75.0 74.1
      Barcode 91 (forward) 73.1 74.1
      Barcode 92 (forward) 75.0 76.9
      Barcode 93 (forward) 76.0 80.0
      Barcode 94 (forward) 75.0 76.0
      Barcode 95 (forward) 80.0 80.8
      Barcode 96 (forward) 79.2 76.0


      Trimming adapters from read ends
      SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
      SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
      1D2_part_2_start: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT
      1D2_part_2_end: CACCCAAGCAGACGCCAGCAATACGTAACT

      1,634,477 / 1,634,477 (100.0%)

      1,150,024 / 1,634,477 reads had adapters trimmed from their start (40,250,129 bp removed)
      419,580 / 1,634,477 reads had adapters trimmed from their end (6,338,306 bp removed)


      Splitting reads containing middle adapters
      1,634,477 / 1,634,477 (100.0%)

      1,202 / 1,634,477 reads were split based on middle adapters


      Outputting trimmed reads to stdout
      Done

       

  • Bioinformatics jobs at https://www.monster.com/jobs/search/?q=Bioinformatics&intcid=skr_navigation_nhpso_searchMain&jobid=198508604
  • GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references. java -Xms2G -Xmx4G -jar...
  • ARC is a pipeline which facilitates iterative, reference guided de novo assemblies with the intent of: Reducing time in analysis and increasing accuracy of results by only considering those reads which should assemble...
  • FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually: minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta...
  • Software package for signal-level analysis of Oxford Nanopore sequencing data. Nanopolish can calculate an improved consensus sequence for a draft genome assembly, detect base modifications, call SNPs and indels with respect to a reference genome...
    Comments
    • Rahul Nayak 2922 days ago
      # Index the draft genome
      bwa index draft.fa
      
      # Align the basecalled reads to the draft sequence
      bwa mem -x ont2d -t 8 draft.fa reads.fa | samtools sort -o reads.sorted.bam -T reads.tmp -
      samtools index reads.sorted.bam


      python nanopolish_makerange.py draft.fa | parallel --results nanopolish.results -P 8 \
          nanopolish variants --consensus -o polished.{1}.vcf -w {1} -r reads.fa -b reads.sorted.bam -g draft.fa -t 4 --min-candidate-frequency 0.1

      nanopolish vcf2fasta -g draft.fa polished.*.vcf > polished_genome.fa
  • EUROPE EURAXESS https://euraxess.ec.europa.eu/site/search?keywords=bioinformatics
  • Neel is now a friend with Rooby Yadav 2938 days ago