BOL: All Site Activity

All Site Activity

- Rahul Nayak@rahul
Rahul Nayak commented on a bookmark Nanopolis: polish a genome assembly 2302 days ago

# Index the draft genome bwa index draft.fa # Align the basecalled reads to the draft sequence bwa mem -x ont2d -t 8 draft.fa reads.fa | samtools sort -o reads.sorted.bam -T reads.tmp - samtools index reads.sorted.bam python...
- Jit@jit.aber
Jit posted to the wire 2306 days ago

#Remove #smartbell from #pacbio #removesmartbell.sh https://github.com/BioInfoTools/BBMap/blob/master/sh/removesmartbell.sh
- Jit@jit.aber
Jit bookmarked LSC :a long read error correction tool 2306 days ago

Getting Started These simple steps will help you integrate LSC into your transcriptomics analysis pipeline. Read the LSC_requirements for running LSC. Download and set-up the LSC package. Follow the tutorial to see how...

https://www.healthcare.uiowa.edu/labs/au/LSC/
- fanhhuizhong@fanhuizhong
fanhhuizhong is now a friend with Shruti Paniwala 2306 days ago
fanhhuizhong@fanhuizhong
Shruti Paniwala@shruti
- Shruti Paniwala@shruti
Shruti Paniwala is now a friend with fanhhuizhong 2306 days ago
Shruti Paniwala@shruti
fanhhuizhong@fanhuizhong
- fanhhuizhong@fanhuizhong
fanhhuizhong is now a friend with Seema Singh 2306 days ago
fanhhuizhong@fanhuizhong
Seema Singh@seema
- Seema Singh@seema
Seema Singh is now a friend with fanhhuizhong 2306 days ago
Seema Singh@seema
fanhhuizhong@fanhuizhong
- fanhhuizhong@fanhuizhong
fanhhuizhong is now a friend with Anjana 2306 days ago
fanhhuizhong@fanhuizhong
Anjana@anjana
- Anjana@anjana
Anjana is now a friend with fanhhuizhong 2306 days ago
Anjana@anjana
fanhhuizhong@fanhuizhong
- Jit@jit.aber
Jit posted to the wire 2308 days ago

Scrubbing long reads https://dazzlerblog.wordpress.com/2017/04/22/1344/ #Scrub #Long #Reads #Pacbio
- Jit@jit.aber
Jit posted to the wire 2308 days ago

Genome assembly https://www2.eecs.berkeley.edu/Pubs/TechRpts/2016/EECS-2016-43.pdf #Genome #Assembly #Tutorial
- Jit@jit.aber
Jit bookmarked REVIGO: Reduced Visualize gene ontology 2308 days ago

REViGO can take long lists of Gene Ontology terms and summarize them by removing redundant GO terms. The remaining terms can be visualized in semantic similarity-based scatterplots, interactive graphs, or tag clouds. More about...

http://revigo.irb.hr/
- Jit@jit.aber
Jit bookmarked nanofilt: Filtering and trimming of long read sequencing data 2309 days ago

Filtering on quality and/or read length, and optional trimming after passing filters.Reads from stdin, writes to stdout. Intended to be used: directly after fastq extraction prior to mapping in a stream between extraction and...

https://github.com/wdecoster/nanofilt
Comments
- Rahul Nayak@rahul
  
  Rahul Nayak 2243 days ago
  Nanofilt steps https://gigabaseorgigabyte.wordpress.com/2017/06/05/trimming-and-filtering-oxford-nanopore-sequencing-reads/
- Jit@jit.aber
Jit posted to the wire 2309 days ago

#Canu #assembly of long reads https://canu.readthedocs.io/en/latest/quick-start.html
- Jit@jit.aber
Jit commented on the bio-script Installing Porechop on Ubuntu ! 2309 days ago

➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa Loading reads/media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta1,634,477 reads loaded Looking for known adapter sets10,000 / 10,000...
- Jit@jit.aber
Jit created a new bio-script Installing Porechop on Ubuntu ! 2309 days ago
Comments
- Jit@jit.aber
  
  Jit 2309 days ago
  ➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa
  Loading reads
  /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta
  1,634,477 reads loaded
  
  Looking for known adapter sets
  10,000 / 10,000 (100.0%)
  Best
  read Best
  start read end
  Set %ID %ID
  SQK-NSK007 96.6 81.8
  Rapid 66.1 0.0
  SQK-MAP006 80.0 82.6
  SQK-MAP006 Short 76.9 76.0
  PCR adapters 1 82.6 78.3
  PCR tail 1 76.7 75.9
  PCR tail 2 79.3 77.4
  1D^2 part 1 74.1 76.7
  1D^2 part 2 91.2 80.6
  Barcode 1 (reverse) 76.0 78.6
  Barcode 2 (reverse) 79.2 80.0
  Barcode 3 (reverse) 80.0 75.0
  Barcode 4 (reverse) 80.0 77.8
  Barcode 5 (reverse) 73.1 76.9
  Barcode 6 (reverse) 76.0 76.9
  Barcode 7 (reverse) 79.2 79.2
  Barcode 8 (reverse) 81.5 76.0
  Barcode 9 (reverse) 76.0 76.0
  Barcode 10 (reverse) 76.0 78.6
  Barcode 11 (reverse) 79.2 80.8
  Barcode 12 (reverse) 80.0 83.3
  Barcode 1 (forward) 83.3 80.0
  Barcode 2 (forward) 80.0 80.0
  Barcode 3 (forward) 76.9 76.0
  Barcode 4 (forward) 80.8 76.9
  Barcode 5 (forward) 75.0 75.0
  Barcode 6 (forward) 76.9 76.9
  Barcode 7 (forward) 80.0 79.2
  Barcode 8 (forward) 76.9 76.9
  Barcode 9 (forward) 80.0 76.9
  Barcode 10 (forward) 77.8 79.2
  Barcode 11 (forward) 76.9 80.0
  Barcode 12 (forward) 79.2 79.2
  Barcode 13 (forward) 76.9 80.0
  Barcode 14 (forward) 76.0 74.1
  Barcode 15 (forward) 73.1 75.0
  Barcode 16 (forward) 76.0 79.2
  Barcode 17 (forward) 76.0 75.0
  Barcode 18 (forward) 76.9 78.6
  Barcode 19 (forward) 78.6 80.8
  Barcode 20 (forward) 80.0 79.2
  Barcode 21 (forward) 79.2 80.0
  Barcode 22 (forward) 79.2 80.0
  Barcode 23 (forward) 75.0 75.0
  Barcode 24 (forward) 80.8 76.0
  Barcode 25 (forward) 76.9 77.8
  Barcode 26 (forward) 80.0 77.8
  Barcode 27 (forward) 76.0 76.9
  Barcode 28 (forward) 80.0 77.8
  Barcode 29 (forward) 76.0 76.0
  Barcode 30 (forward) 80.0 76.9
  Barcode 31 (forward) 79.2 77.8
  Barcode 32 (forward) 76.0 79.2
  Barcode 33 (forward) 76.9 76.0
  Barcode 34 (forward) 76.0 79.2
  Barcode 35 (forward) 76.0 75.0
  Barcode 36 (forward) 76.0 76.0
  Barcode 37 (forward) 80.0 80.0
  Barcode 38 (forward) 76.0 80.8
  Barcode 39 (forward) 74.1 76.0
  Barcode 40 (forward) 79.2 76.0
  Barcode 41 (forward) 76.0 77.8
  Barcode 42 (forward) 76.0 80.0
  Barcode 43 (forward) 76.9 79.2
  Barcode 44 (forward) 76.0 75.0
  Barcode 45 (forward) 76.0 76.9
  Barcode 46 (forward) 79.2 76.0
  Barcode 47 (forward) 76.0 75.0
  Barcode 48 (forward) 79.2 76.0
  Barcode 49 (forward) 80.8 78.6
  Barcode 50 (forward) 75.0 76.9
  Barcode 51 (forward) 76.0 76.0
  Barcode 52 (forward) 76.9 79.2
  Barcode 53 (forward) 76.0 76.9
  Barcode 54 (forward) 76.9 80.0
  Barcode 55 (forward) 79.2 77.8
  Barcode 56 (forward) 80.0 76.0
  Barcode 57 (forward) 75.0 76.0
  Barcode 58 (forward) 75.0 75.0
  Barcode 59 (forward) 76.9 79.2
  Barcode 60 (forward) 75.0 76.9
  Barcode 61 (forward) 73.1 76.0
  Barcode 62 (forward) 76.9 76.0
  Barcode 63 (forward) 76.0 77.8
  Barcode 64 (forward) 81.5 79.2
  Barcode 65 (forward) 76.0 76.9
  Barcode 66 (forward) 76.0 76.9
  Barcode 67 (forward) 76.9 76.9
  Barcode 68 (forward) 79.2 79.2
  Barcode 69 (forward) 76.9 76.9
  Barcode 70 (forward) 76.9 76.0
  Barcode 71 (forward) 77.8 76.0
  Barcode 72 (forward) 80.0 76.0
  Barcode 73 (forward) 79.2 80.0
  Barcode 74 (forward) 77.8 76.9
  Barcode 75 (forward) 79.2 76.0
  Barcode 76 (forward) 80.0 79.2
  Barcode 77 (forward) 76.0 76.0
  Barcode 78 (forward) 80.0 80.8
  Barcode 79 (forward) 76.9 80.0
  Barcode 80 (forward) 76.9 76.9
  Barcode 81 (forward) 77.8 80.0
  Barcode 82 (forward) 77.8 75.0
  Barcode 83 (forward) 77.8 80.0
  Barcode 84 (forward) 75.0 75.0
  Barcode 85 (forward) 76.9 76.9
  Barcode 86 (forward) 76.0 76.0
  Barcode 87 (forward) 76.0 76.9
  Barcode 88 (forward) 80.8 76.0
  Barcode 89 (forward) 79.2 80.0
  Barcode 90 (forward) 75.0 74.1
  Barcode 91 (forward) 73.1 74.1
  Barcode 92 (forward) 75.0 76.9
  Barcode 93 (forward) 76.0 80.0
  Barcode 94 (forward) 75.0 76.0
  Barcode 95 (forward) 80.0 80.8
  Barcode 96 (forward) 79.2 76.0
  
  Trimming adapters from read ends
  SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
  SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
  1D2_part_2_start: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT
  1D2_part_2_end: CACCCAAGCAGACGCCAGCAATACGTAACT
  1,634,477 / 1,634,477 (100.0%)
  1,150,024 / 1,634,477 reads had adapters trimmed from their start (40,250,129 bp removed)
  419,580 / 1,634,477 reads had adapters trimmed from their end (6,338,306 bp removed)
  
  Splitting reads containing middle adapters
  1,634,477 / 1,634,477 (100.0%)
  1,202 / 1,634,477 reads were split based on middle adapters
  
  Outputting trimmed reads to stdout
  Done
- Jit@jit.aber
Jit posted to the wire 2309 days ago

Long read extraction https://github.com/rrwick/Unicycler/wiki/Read-extraction #Reads #Extractions #Long #PacBio #Ont
- Jit@jit.aber
Jit posted to the wire 2309 days ago

Assembly Conversion https://ics.hutton.ac.uk/tablet/assembly-conversion/ #Assembly #Conversion #NGS
- Abhimanyu Singh@abhimanyu
Abhimanyu Singh commented on a bookmark List of Bioinformatics Vacancy, Jobs, Opportunity websites 2309 days ago

Bioinformatics jobs at https://www.monster.com/jobs/search/?q=Bioinformatics&intcid=skr_navigation_nhpso_searchMain&jobid=198508604
- Jit@jit.aber
Jit bookmarked GFinisher: a new strategy to refine and finish bacterial genome assemblies 2313 days ago

GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references. java -Xms2G -Xmx4G -jar...

http://gfinisher.sourceforge.net

BOL

Our Sponsors

All Site Activity