Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.






All site questions

  • Any
    3289 days ago
    Questions (2)

    In school the teachers refer to both terms as one, but according to what I have read they are not the same and don't use the same methologies so I am a bit confused.

  • Marysia
    3291 days ago
    Questions (1)

    I used the following command to print the blast hit.

    [Terminal] blastn -query aaa.fa -db blastdb/nt -evalue 10e-5 -num_threads 4 -max_target_seqs 1 -outfmt '6 qseqid staxid qstart qend sallseqi sstart send evalue length frames qcovs' -out testBlastSee

    But the outfile print many hits, I only want the top one.

    [Terminal] more testBlastSee                                                                                                                  []
    Lactococcus_lactis    1    63350    1    63350    0.0    63350    1/1    100
    Lactococcus_lactis    52453    55105    138601    141250    0.0    2654    1/1    100
    Lactococcus_lactis    52393    53898    629230    627727    0.0    1508    1/1    100
    Lactococcus_lactis    52411    53898    2217595    2216111    0.0    1489    1/1    100
    Lactococcus_lactis    52413    53898    2157259    2155777    0.0    1487    1/1    100
    Lactococcus_lactis    52452    53898    838503    837059    0.0    1449    1/1    100
    Lactococcus_lactis    52453    53860    374322    375726    0.0    1409    1/1    100
    Lactococcus_lactis    53859    55105    2154570    2155816    0.0    1247    1/1    100
    Lactococcus_lactis    53860    55105    626521    627766    0.0    1246    1/1    100
    Lactococcus_lactis    53858    55105    835851    837098    0.0    1248    1/1    100
    Lactococcus_lactis    53860    55105    2214905    2216150    0.0    1246    1/1    100
    Lactococcus_lactis    53860    55104    374321    373077    0.0    1245    1/1    100
    Lactococcus_lactis    53860    55104    138600    137356    0.0    1245    1/1    100
    Lactococcus_lactis    53860    55104    839748    838504    0.0    1245    1/1    100
    Lactococcus_lactis    40213    41128    508317    507400    0.0    922    1/1    100
    Lactococcus_lactis    28448    28695    543445    543703    9e-96    260    1/1    100
    Lactococcus_lactis    42193    42376    506963    506780    4e-64    184    1/1    100
    Lactococcus_lactis    61964    62163    61646    61845    6e-53    200    1/1    100
    Lactococcus_lactis    61646    61845    61964    62163    6e-53    200    1/1    100
    Lactococcus_lactis    37541    37672    512963    512832    3e-50    132    1/1    100
    Lactococcus_lactis    28816    28933    2360018    2359903    7e-32    118    1/1    100
    Lactococcus_lactis    35284    35410    1439702    1439828    1e-30    129    1/1    100
    Lactococcus_lactis    28272    28363    1412439    1412348    1e-29    92    1/1    100
    Lactococcus_lactis    28193    28270    2360127    2360050    2e-28    78    1/1    100
    Lactococcus_lactis    28695    28813    542396    542514    6e-23    122    1/1    100
    Lactococcus_lactis    28695    28813    1981268    1981150    6e-23    122    1/1    100
    Lactococcus_lactis    28695    28813    2341071    2340953    6e-23    122    1/1    100
    Lactococcus_lactis    28695    28812    2360250    2360133    2e-22    121    1/1    100
    Lactococcus_lactis    28695    28796    2218330    2218229    8e-22    103    1/1    100
    Lactococcus_lactis    28695    28796    2260841    2260740    8e-22    103    1/1    100
    Lactococcus_lactis    55066    55147    2154609    2154528    2e-17    82    1/1    100
    Lactococcus_lactis    55066    55148    626559    626478    5e-14    83    1/1    100
    Lactococcus_lactis    52392    52456    373013    373076    2e-12    65    1/1    100
    Lactococcus_lactis    55105    55148    375723    375766    1e-09    44    1/1    100
    Lactococcus_lactis    52393    52457    839809    839745    1e-09    66    1/1    100

  • Anjana
    3299 days ago
    Questions (0)

    When I tried Perl on my cluster/server it gives following error !! How to resolve it?

    $ perl
    perl: warning: Setting locale failed.
    perl: warning: Please check that your locale settings:
    LANGUAGE = (unset),
    LC_ALL = (unset),
    LC_PAPER = "de_BE.UTF-8",
    LC_ADDRESS = "de_BE.UTF-8",
    LC_MONETARY = "de_BE.UTF-8",
    LC_NUMERIC = "de_BE.UTF-8",
    LC_TELEPHONE = "de_BE.UTF-8",
    LC_IDENTIFICATION = "de_BE.UTF-8",
    LC_MEASUREMENT = "de_BE.UTF-8",
    LC_TIME = "de_BE.UTF-8",
    LC_NAME = "de_BE.UTF-8",
    LANG = "en_US.UTF-8"
    are supported and installed on your system.
    perl: warning: Falling back to a fallback locale ("en_US.UTF-8").

  • Shruti Paniwala
    3301 days ago
    Questions (2)

    I am problem installing Perl module on cluster/server without root. Can you please recommend me a easy way or alternative way to install it.

  • Shruti Paniwala
    3304 days ago
    Questions (1)

    I am looking for new, interactive and user friendly tools to see chromosomal rearrangements. I tried IGV, but it does not seems to be very helpful for chromosomal rearrangements visualization. Circos look pretty useless, as it does not allow me to explore well. Help Please...

  • Neel
    3305 days ago
    Questions (3)

    Extract "Seq2" from the list below

    >Seq1
    GTGCACTAAGAAAAATAAAATTTGTTCTTTTAAGATAATCATTTC
    CTGGACGAATATCAATAGCAATAGAATAAGTCCAATCAAATGAT
    TGCCGTGATGAACGAACTTGTAATTGTTGATAACTAGAACCAT
    GCTGTAAACAAAATTTTGATGACCATTGTGGTCGACCTTCTTGT
    TGACGATGTAAACCATTTCCAACTCGCATAACACATGTATTATTA
    CGCTGAGCATTATCGAAAGAAAGAAGAAGT
    >Seq2
    CAGGGCCAGCGCCGCCGACAGGCCGGTGAAGCCGCCGCCGA
    CGATGGCCACGTCCACCTGCGCCGGCAGGTCTTGCGACCGCG
    GCACGAAGGCGGGGGCGGAATCGGTCCAGTACGGGTCGAGCT
    TCATGGCGGCGGCGAGGGGCGGGAAGGGCAGCGTTCGATCAG
    GGGCCGGGGTTCAGAGACCCACCACGCCGGGCAGGCCGCCGA
    TGTCCTGGATCTCGACATAGCGATAGGCCGGGTTGCCCGGGC

  • mahree khan
    3311 days ago
    Questions (2)

    I want to publish my research work on miRNA. I used online "freely" available miRNA dataset, with not known publications, and analysed it. Can you please suggest your experience publishing it in a good Impact Factor Journal? Is this possible to published it? 

  • Abhimanyu Singh
    3319 days ago
    Questions (2)

    I got the following error while running MizBee.How to fiw it.

    ./MizBee                                    []
    OpenJDK 64-Bit Server VM warning: You have loaded library /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so which might have disabled stack guard. The VM will try to fix the stack guard now.
    It's highly recommended that you fix the library with 'execstack -c ', or link it with '-z noexecstack'.
    Exception in thread "Animation Thread" java.lang.UnsatisfiedLinkError: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: wrong ELF class: ELFCLASS32 (Possible cause: architecture word width mismatch)
        at java.lang.ClassLoader$NativeLibrary.load(Native Method)
        at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1941)
        at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1857)
        at java.lang.Runtime.loadLibrary0(Runtime.java:870)
        at java.lang.System.loadLibrary(System.java:1122)
        at com.sun.gluegen.runtime.NativeLibLoader.loadLibraryInternal(NativeLibLoader.java:102)
        at com.sun.gluegen.runtime.NativeLibLoader.access$000(NativeLibLoader.java:51)
        at com.sun.gluegen.runtime.NativeLibLoader$1.run(NativeLibLoader.java:70)
        at java.security.AccessController.doPrivileged(Native Method)
        at com.sun.gluegen.runtime.NativeLibLoader.loadGlueGenRT(NativeLibLoader.java:68)
        at com.sun.gluegen.runtime.NativeLibrary.ensureNativeLibLoaded(NativeLibrary.java:399)
        at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:163)
        at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:129)
        at com.sun.opengl.impl.x11.DRIHack.begin(DRIHack.java:109)
        at com.sun.opengl.impl.x11.X11GLDrawableFactory.(X11GLDrawableFactory.java:99)
        at java.lang.Class.forName0(Native Method)
        at java.lang.Class.forName(Class.java:264)
        at javax.media.opengl.GLDrawableFactory.getFactory(GLDrawableFactory.java:111)
        at processing.opengl.PGraphicsOpenGL.allocate(PGraphicsOpenGL.java:173)
        at processing.core.PGraphics3D.setSize(PGraphics3D.java:323)
        at processing.core.PApplet.makeGraphics(PApplet.java:1321)
        at processing.core.PApplet.size(PApplet.java:1142)
        at processing.core.PApplet.size(PApplet.java:1102)
        at MizBee.setup(MizBee.java:87)
        at processing.core.PApplet.handleDraw(PApplet.java:1571)
        at processing.core.PApplet.run(PApplet.java:1496)
        at java.lang.Thread.run(Thread.java:745)

  • Poonam Mahapatra
    3320 days ago
    Questions (1)

    I tried SyMAP but got the following error 

    $ ./symap []

    Starting SyMAP v4.2 - Project Manager
    SyMAP Version v4.2
    Java Version 1.8.0_91, mem: 1820M
    Build 116
    Reading from file symap.config
    The built-in MySQL server cannot run because a MySQL server is already running on this computer.
    Please stop that server, or else specify a MySQL host name in the symap.config file.

  • pradyumna Jayaram
    3349 days ago
    Questions (1)

    If i have a set of miRNA sequences, what are the tools that are available to predict the target genes? I tried miRanda and mirdb, are there any  tools or databases that do the same, as the rna is not already known i cant use targetscan etc. The tool must predict the target from the fasta sequence of miRNA.

    Thank you