BOL: Results for "kmer"

Results for "kmer"

- Surabhi Chaudhary@surabhi
BBTools for bioinformatician !
...sking of low-complexity repetitive kmers, which is not usually a prob...ition 19, zero-based). Code: $ kmercountexact.sh in=trimmed.fq ou...p; Extract sequences that share kmers with your sequences with BBD...for sequence data Code: $ kmercountexact.sh in=reads.fq khis...
2297 days ago
- Neelam Jha@neelam
Useful Bioinformatics Analysis Tools !
...ting on a PC, BMC Bioinformatics, 2013; 14():Article no. 160, Kmer-db Tool for estimation of ev...; Deorowicz, S., Gudys, A., Dlugosz, M., Kokot, M., Danek, A., Kmer-db: instant evolutionary dist...
890 days ago

- Jit@jit.aber
Understanding Fastqc Output
Understanding Following table and graphs Duplication level kmer profile per base GC content per base N content per base quality per base sequence content per sequence GC con...
2969 days ago
- Jit@jit.aber
HGA
...specified assembler (Velvet or SPAdes in this version) and using a given kmer size. 3. Merging all the asse...ion. 4. Combining all the assemblies of the partition (using velvet with kmer value of 31). 5. Finaly, re-a...
2741 days ago
+13 more Bookmarks

- Jit@jit.aber
Frequent words problem solution by Perl
...my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0;for (...bsp; my $myStr=substr $string, $aa,$kmer; #print "$m...; print "$name " if $myHash{$name} == $max;}sub kmerMatch { #Check the exact match...
3279 days ago
- Jit@jit.aber
Pattern Matching Problem Solution with Perl
...where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="ATAT";my $kmer=length($subStr);kmerMatch ($string, $subStr, $kmer...
3279 days ago
+1 more Pages

- Surabhi Chaudhary@surabhi
Commercial and public next-gen-seq (NGS) software
...homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence nu...
3546 days ago
- Rahul Nayak@rahul
Software packages for next gen sequence analysis
...homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence nu...
3269 days ago
+1 more Top-level pages

- Jit@jit.aber
Tetramer frequency: http://cgat.readthedocs.io/en/latest/recipes/metagenome_contigs_kmers.html #Kmer #Tetra #R #CGAT
2629 days ago
- Jit@jit.aber
Learning Data Science: Understanding and Using k-means Clustering https://www.r-bloggers.com/learning-data-science-understanding-and-using-k-means-clustering/ #R #Clustering #Learn #Kmer
1769 days ago
+1 more Wire posts

- Jit@jit.aber
Clump Finding Problem Solved with Perl
...TGCGACATAATGTACGAATGTAATGTGCCTATGGC"; my $subStr="?"; my $clump=4; my $kmer=5; for (my $aa=0; $aa $max...e (keys %myHash){ print "$name " if $myHash{$name} == $clump; } kmerMatch ($string, $subStr, $kmer...
2361 days ago
- Jit@jit.aber
Running Trinity on RNA-seq !
...MD: jellyfish histo -t 40 -o jellyfish.K25.min2.kmers.fa.histo mer_counts.jf CMD...sh dump -L 2 mer_counts.jf > jellyfish.K25.min2.kmers.fa CMD finished (16 seconds...: jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa * Running CMD: jellyfish...
2154 days ago
+6 more Bio-Scripts

- Neelam Jha@neelam
Comment on "KAT: a K-mer analysis toolkit to quality control NGS datasets and genome assemblies"
...;gnuplot/4.6.5) – we can plot the kmer content of the assembly compared to the kmer content of the read set. The...now use kat comp to create a kmer content comparison. Use ...png file that was produced. Does the kmer content look good to you? Ho...
1364 days ago
- Abhimanyu Singh@abhimanyu
Comment on "Estimate Genome Size"
...find_valleys.pl to help pinpoint the actual peak find_valleys.pl fastq.counts_0.histo # estimate the size and coverage estimate_genome_size.pl --kmer=31 --peak=42 --fastq=reads1.f...
1924 days ago
+5 more Comments