Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2083 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2083 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail -------------------------------------------------------- /usr/share/Modules/modulefiles -------------------------------------------...2074 days ago
Setting up falconUnzip conda environments for genome assembly !
➜ Analysis_Results conda create -n denovo_asm Solving environment: done ## Package Plan ## environment location: /home/urbe/anaconda3/envs/denovo_asm Proc...2030 days ago
Finding Kmers from fasta sequence file
Save it in sample.fa >test TAATGCCATGGGATGTT jellyfish count -m 3 -s 100000 sample.fa -o sample.jf jellyfish dump -c sample.jf It return TGT 1 GAT 1 GGG 1 GGA 1 CAT 1 TGC 1 TAA 1 GCC 1 CCA 1 GTT 1 TGG 1 ATG 3 AAT 12012 days ago
Perl script to split fasta sequence and create overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2012 days ago
Perl script to run in parellel !
#!/usr/bin/perl use strict; use warnings; use Parallel::ForkMan...ger; use Bio::SeqIO; my ($sequence_data_ref) = parse_genome_files($ARGV[0]); my %genome=%{$sequence_data_ref}; my $n_processes...my $file=shift; my (%sequence_data); my $file_content...1727 days ago
Perl subroutine to creating kmer !
sub k_mers { my ($sequence, $k) = @_; my $len = length($sequence); my @result = (); for (my $i = 0; $i1607 days ago
Bash script to download SRA file !
#We can use the sratoolkit to directly pull the sequence data (in paired FASTQ format) from the archive. fastq-dump is in the SRA toolkit. It allows directly downloading data fro...1599 days ago
Pack a perl program with their dependencies on Ubuntu !
#Follow steps to create your own executable ./web jit@jit-HP-Pro-3335-MT:~/Downloads/...perl script analyzing codon usage in an input sequence to evaluate how efficiently i...genomes, enabling new insights into evolution and sequence....1551 days ago