Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-...2905 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::Du...nally written by Abigail # Documentation for the algorithm is at # http://theoryx5.uwin...t => 0, fitness => 0 }; } } __DATA__ about algori...2371 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGA...Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algori...2325 days ago
2075 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print...e complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algori...2043 days ago
2026 days ago
2019 days ago
Pack a perl program with their dependencies on Ubuntu !
#Follow steps to create your own executable ./web jit@jit-HP-Pro-3335-MT:~/Downloads...Biostats materials ... Biostatistics is an innovative field that involves the design, analysis, and interpretation...1511 days ago
1215 days ago
Tadpole is 250x faster than SPADes assembler !
lege@jit-Lenovo-ideapad-320-15ISK:~/Downloads/MyTools/Vir$ tadpole.sh Written by Brian Bushnell...s. reassemble=t If ecc is enabled, use the reassemble algorithm. pincer=f If ecc is enabled, use the pincer algori...976 days ago