Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2042 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail ----------------------...ssibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...ssibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...2033 days ago
2033 days ago
Setting up falconUnzip conda environments for genome assembly !
...$ conda deactivate ➜ Analysis_Results source activate denovo_asm (denovo_asm) ➜ Analysis_Results conda install pb-asse...e currently available SMRT(R) Analysis builds. While # # efforts ha...e currently available SMRT(R) Analysis builds. While # # efforts ha...1989 days ago
Bash commandline to install Anaconda !
#The line begins with $ are the commands $ mkdir tmp $ cd tmp/ $ curl -O https://repo.anaconda.com/archive/Anaconda3-2019.03-Linux-x86_64.sh % Total % Re...1554 days ago
Installing ggplot2 and its dependencies on Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads/MitoHunter/minidot/bin$ sudo R [sudo] password for jit: R version 3.4.4 (2018-03-15) -- "Someone to Lean On" Copyright (C) 2018...1549 days ago
Installing docker for Bioinformatics on Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads$ sudo apt-get remove docker docker-engine docker.io containerd runc Reading package lists... Done Building dependency tree R...1512 days ago
Pack a perl program with their dependencies on Ubuntu !
#Follow steps to create your own executable ./web jit@jit-HP-Pro-3335-MT:~/Downloads/...materials ... Biostatistics is an innovative field that involves the design, analysis, and interpretation of data f...1510 days ago
Commands to install conda in Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads$ mkdir jittmp jit@jit-HP-Pro-3335-MT:~/Downloads$ cd jittmp/ jit@jit-HP-Pro-3335-MT:~/Downloads/jittmp$ curl -O https://repo.anaco...1510 days ago
1508 days ago