Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2054 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2054 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail ---------------------...ossibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...ossibly newer than the currently available SMRT(R) Analysis builds. While # # efforts ha...2045 days ago
Setting up falconUnzip conda environments for genome assembly !
...$ conda deactivate ➜ Analysis_Results source activate denovo_asm (denovo_asm) ➜ Analysis_Results conda install pb-asse...e currently available SMRT(R) Analysis builds. While # # efforts ha...e currently available SMRT(R) Analysis builds. While # # efforts ha...2001 days ago
Finding Kmers from fasta sequence file
Save it in sample.fa >test TAATGCCATGGGATGTT jellyfish count -m 3 -s 100000 sample.fa -o sample.jf jellyfish dump -c sample.jf It return TGT 1 GAT 1 GGG 1 GGA 1 CAT 1 TGC 1 TAA 1 GCC 1 CCA 1 GTT 1 TGG 1 ATG 3 AAT 11983 days ago
Perl script to split fasta sequence and create overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "1983 days ago
Perl script to run in parellel !
#!/usr/bin/perl use strict; use warnings; use Parallel::ForkMan...ger; use Bio::SeqIO; my ($sequence_data_ref) = parse_genome_files($ARGV[0]); my %genome=%{$sequence_data_ref}; my $n_processes...my $file=shift; my (%sequence_data); my $file_content...1697 days ago
Perl subroutine to creating kmer !
sub k_mers { my ($sequence, $k) = @_; my $len = length($sequence); my @result = (); for (my $i = 0; $i1578 days ago
Bash script to download SRA file !
#We can use the sratoolkit to directly pull the sequence data (in paired FASTQ format) from the archive. fastq-dump is in the SRA toolkit. It allows directly downloading data fro...1570 days ago
Pack a perl program with their dependencies on Ubuntu !
...perl script analyzing codon usage in an input sequence to evaluate how efficiently i...mes, enabling new insights into evolution and sequence... Latest groups Bioinform...an innovative field that involves the design, analysis, and interpretation of data f...1522 days ago