BOL

Latest activity

• • Seema Singh@seema

  

  Seema Singh is now a friend with fanhhuizhong 2354 days ago

  • Seema Singh@seema

  

  • fanhhuizhong@fanhuizhong

  
• • fanhhuizhong@fanhuizhong

  

  fanhhuizhong is now a friend with Anjana 2354 days ago

  • fanhhuizhong@fanhuizhong

  

  • Anjana@anjana

  
• • Anjana@anjana

  

  Anjana is now a friend with fanhhuizhong 2354 days ago

  • Anjana@anjana

  

  • fanhhuizhong@fanhuizhong

  
• • Jit@jit.aber

  

  Jit posted to the wire 2356 days ago

  Scrubbing long reads https://dazzlerblog.wordpress.com/2017/04/22/1344/ #Scrub #Long #Reads #Pacbio
• • Jit@jit.aber

  

  Jit posted to the wire 2356 days ago

  Genome assembly https://www2.eecs.berkeley.edu/Pubs/TechRpts/2016/EECS-2016-43.pdf #Genome #Assembly #Tutorial
• • Jit@jit.aber

  

  Jit bookmarked REVIGO: Reduced Visualize gene ontology 2356 days ago

  REViGO can take long lists of Gene Ontology terms and summarize them by removing redundant GO terms. The remaining terms can be visualized in semantic similarity-based scatterplots, interactive graphs, or tag clouds. More about...

  http://revigo.irb.hr/
• • Jit@jit.aber

  

  Jit bookmarked nanofilt: Filtering and trimming of long read sequencing data 2357 days ago

  Filtering on quality and/or read length, and optional trimming after passing filters.Reads from stdin, writes to stdout. Intended to be used: directly after fastq extraction prior to mapping in a stream between extraction and...

  https://github.com/wdecoster/nanofilt

  Comments

  • • Rahul Nayak@rahul

    

    Rahul Nayak 2290 days ago

    Nanofilt steps https://gigabaseorgigabyte.wordpress.com/2017/06/05/trimming-and-filtering-oxford-nanopore-sequencing-reads/
• • Jit@jit.aber

  

  Jit posted to the wire 2357 days ago

  #Canu #assembly of long reads https://canu.readthedocs.io/en/latest/quick-start.html
• • Jit@jit.aber

  

  Jit commented on the bio-script Installing Porechop on Ubuntu ! 2357 days ago

  ➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa Loading reads/media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta1,634,477 reads loaded Looking for known adapter sets10,000 / 10,000...
• • Jit@jit.aber

  

  Jit created a new bio-script Installing Porechop on Ubuntu ! 2357 days ago

  Comments

  • • Jit@jit.aber

    

    Jit 2357 days ago

    ➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa

    Loading reads
    /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta
    1,634,477 reads loaded

    
    Looking for known adapter sets
    10,000 / 10,000 (100.0%)
    Best
    read Best
    start read end
    Set %ID %ID
    SQK-NSK007 96.6 81.8
    Rapid 66.1 0.0
    SQK-MAP006 80.0 82.6
    SQK-MAP006 Short 76.9 76.0
    PCR adapters 1 82.6 78.3
    PCR tail 1 76.7 75.9
    PCR tail 2 79.3 77.4
    1D^2 part 1 74.1 76.7
    1D^2 part 2 91.2 80.6
    Barcode 1 (reverse) 76.0 78.6
    Barcode 2 (reverse) 79.2 80.0
    Barcode 3 (reverse) 80.0 75.0
    Barcode 4 (reverse) 80.0 77.8
    Barcode 5 (reverse) 73.1 76.9
    Barcode 6 (reverse) 76.0 76.9
    Barcode 7 (reverse) 79.2 79.2
    Barcode 8 (reverse) 81.5 76.0
    Barcode 9 (reverse) 76.0 76.0
    Barcode 10 (reverse) 76.0 78.6
    Barcode 11 (reverse) 79.2 80.8
    Barcode 12 (reverse) 80.0 83.3
    Barcode 1 (forward) 83.3 80.0
    Barcode 2 (forward) 80.0 80.0
    Barcode 3 (forward) 76.9 76.0
    Barcode 4 (forward) 80.8 76.9
    Barcode 5 (forward) 75.0 75.0
    Barcode 6 (forward) 76.9 76.9
    Barcode 7 (forward) 80.0 79.2
    Barcode 8 (forward) 76.9 76.9
    Barcode 9 (forward) 80.0 76.9
    Barcode 10 (forward) 77.8 79.2
    Barcode 11 (forward) 76.9 80.0
    Barcode 12 (forward) 79.2 79.2
    Barcode 13 (forward) 76.9 80.0
    Barcode 14 (forward) 76.0 74.1
    Barcode 15 (forward) 73.1 75.0
    Barcode 16 (forward) 76.0 79.2
    Barcode 17 (forward) 76.0 75.0
    Barcode 18 (forward) 76.9 78.6
    Barcode 19 (forward) 78.6 80.8
    Barcode 20 (forward) 80.0 79.2
    Barcode 21 (forward) 79.2 80.0
    Barcode 22 (forward) 79.2 80.0
    Barcode 23 (forward) 75.0 75.0
    Barcode 24 (forward) 80.8 76.0
    Barcode 25 (forward) 76.9 77.8
    Barcode 26 (forward) 80.0 77.8
    Barcode 27 (forward) 76.0 76.9
    Barcode 28 (forward) 80.0 77.8
    Barcode 29 (forward) 76.0 76.0
    Barcode 30 (forward) 80.0 76.9
    Barcode 31 (forward) 79.2 77.8
    Barcode 32 (forward) 76.0 79.2
    Barcode 33 (forward) 76.9 76.0
    Barcode 34 (forward) 76.0 79.2
    Barcode 35 (forward) 76.0 75.0
    Barcode 36 (forward) 76.0 76.0
    Barcode 37 (forward) 80.0 80.0
    Barcode 38 (forward) 76.0 80.8
    Barcode 39 (forward) 74.1 76.0
    Barcode 40 (forward) 79.2 76.0
    Barcode 41 (forward) 76.0 77.8
    Barcode 42 (forward) 76.0 80.0
    Barcode 43 (forward) 76.9 79.2
    Barcode 44 (forward) 76.0 75.0
    Barcode 45 (forward) 76.0 76.9
    Barcode 46 (forward) 79.2 76.0
    Barcode 47 (forward) 76.0 75.0
    Barcode 48 (forward) 79.2 76.0
    Barcode 49 (forward) 80.8 78.6
    Barcode 50 (forward) 75.0 76.9
    Barcode 51 (forward) 76.0 76.0
    Barcode 52 (forward) 76.9 79.2
    Barcode 53 (forward) 76.0 76.9
    Barcode 54 (forward) 76.9 80.0
    Barcode 55 (forward) 79.2 77.8
    Barcode 56 (forward) 80.0 76.0
    Barcode 57 (forward) 75.0 76.0
    Barcode 58 (forward) 75.0 75.0
    Barcode 59 (forward) 76.9 79.2
    Barcode 60 (forward) 75.0 76.9
    Barcode 61 (forward) 73.1 76.0
    Barcode 62 (forward) 76.9 76.0
    Barcode 63 (forward) 76.0 77.8
    Barcode 64 (forward) 81.5 79.2
    Barcode 65 (forward) 76.0 76.9
    Barcode 66 (forward) 76.0 76.9
    Barcode 67 (forward) 76.9 76.9
    Barcode 68 (forward) 79.2 79.2
    Barcode 69 (forward) 76.9 76.9
    Barcode 70 (forward) 76.9 76.0
    Barcode 71 (forward) 77.8 76.0
    Barcode 72 (forward) 80.0 76.0
    Barcode 73 (forward) 79.2 80.0
    Barcode 74 (forward) 77.8 76.9
    Barcode 75 (forward) 79.2 76.0
    Barcode 76 (forward) 80.0 79.2
    Barcode 77 (forward) 76.0 76.0
    Barcode 78 (forward) 80.0 80.8
    Barcode 79 (forward) 76.9 80.0
    Barcode 80 (forward) 76.9 76.9
    Barcode 81 (forward) 77.8 80.0
    Barcode 82 (forward) 77.8 75.0
    Barcode 83 (forward) 77.8 80.0
    Barcode 84 (forward) 75.0 75.0
    Barcode 85 (forward) 76.9 76.9
    Barcode 86 (forward) 76.0 76.0
    Barcode 87 (forward) 76.0 76.9
    Barcode 88 (forward) 80.8 76.0
    Barcode 89 (forward) 79.2 80.0
    Barcode 90 (forward) 75.0 74.1
    Barcode 91 (forward) 73.1 74.1
    Barcode 92 (forward) 75.0 76.9
    Barcode 93 (forward) 76.0 80.0
    Barcode 94 (forward) 75.0 76.0
    Barcode 95 (forward) 80.0 80.8
    Barcode 96 (forward) 79.2 76.0

    
    Trimming adapters from read ends
    SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
    SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
    1D2_part_2_start: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT
    1D2_part_2_end: CACCCAAGCAGACGCCAGCAATACGTAACT

    1,634,477 / 1,634,477 (100.0%)

    1,150,024 / 1,634,477 reads had adapters trimmed from their start (40,250,129 bp removed)
    419,580 / 1,634,477 reads had adapters trimmed from their end (6,338,306 bp removed)

    
    Splitting reads containing middle adapters
    1,634,477 / 1,634,477 (100.0%)

    1,202 / 1,634,477 reads were split based on middle adapters

    
    Outputting trimmed reads to stdout
    Done

     
• • Jit@jit.aber

  

  Jit posted to the wire 2357 days ago

  Long read extraction https://github.com/rrwick/Unicycler/wiki/Read-extraction #Reads #Extractions #Long #PacBio #Ont
• • Jit@jit.aber

  

  Jit posted to the wire 2357 days ago

  Assembly Conversion https://ics.hutton.ac.uk/tablet/assembly-conversion/ #Assembly #Conversion #NGS
• • Abhimanyu Singh@abhimanyu

  

  Abhimanyu Singh commented on a bookmark List of Bioinformatics Vacancy, Jobs, Opportunity websites 2357 days ago

  Bioinformatics jobs at https://www.monster.com/jobs/search/?q=Bioinformatics&intcid=skr_navigation_nhpso_searchMain&jobid=198508604
• • Jit@jit.aber

  

  Jit bookmarked GFinisher: a new strategy to refine and finish bacterial genome assemblies 2361 days ago

  GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references. java -Xms2G -Xmx4G -jar...

  http://gfinisher.sourceforge.net
• • Jit@jit.aber

  

  Jit bookmarked ARC: pipeline which facilitates iterative, reference guided de novo assemblies 2361 days ago

  ARC is a pipeline which facilitates iterative, reference guided de novo assemblies with the intent of: Reducing time in analysis and increasing accuracy of results by only considering those reads which should assemble...

  https://ibest.github.io/ARC/
• • Rahul Nayak@rahul

  

  Rahul Nayak created a page My commonly used commands in Bioinformatics 2361 days ago

  FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually: minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta...
• • Rahul Nayak@rahul

  

  Rahul Nayak bookmarked Nanopolis: polish a genome assembly 2361 days ago

  Software package for signal-level analysis of Oxford Nanopore sequencing data. Nanopolish can calculate an improved consensus sequence for a draft genome assembly, detect base modifications, call SNPs and indels with respect to a reference genome...

  https://github.com/jts/nanopolish

  Comments

  • • Rahul Nayak@rahul

    

    Rahul Nayak 2350 days ago

    # Index the draft genome
    bwa index draft.fa
    
    # Align the basecalled reads to the draft sequence
    bwa mem -x ont2d -t 8 draft.fa reads.fa | samtools sort -o reads.sorted.bam -T reads.tmp -
    samtools index reads.sorted.bam
    
    
    

    python nanopolish_makerange.py draft.fa | parallel --results nanopolish.results -P 8 \
        nanopolish variants --consensus -o polished.{1}.vcf -w {1} -r reads.fa -b reads.sorted.bam -g draft.fa -t 4 --min-candidate-frequency 0.1

    
    nanopolish vcf2fasta -g draft.fa polished.*.vcf > polished_genome.fa
• • Jit@jit.aber

  

  Jit commented on a bookmark List of Bioinformatics Vacancy, Jobs, Opportunity websites 2363 days ago

  EUROPE EURAXESS https://euraxess.ec.europa.eu/site/search?keywords=bioinformatics
• • Rooby Yadav@Rooby19

  

  Rooby Yadav is now a friend with Neel 2366 days ago

  • Rooby Yadav@Rooby19

  

  • Neel@neelam

  
• • Neel@neelam

  

  Neel is now a friend with Rooby Yadav 2366 days ago

  • Neel@neelam

  

  • Rooby Yadav@Rooby19

  

• « Previous
• 116
• 117
• 118
• 119
• 120
• 121
• 122
• 123
• 124
• 125
• 126
• Next »