Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2057 days ago
Finding Kmers from fasta sequence file
Save it in sample.fa >test TAATGCCATGGGATGTT jellyfish count -m 3 -s 100000 sample.fa -o sample.jf jellyfish dump -c sample.jf It return TGT 1 GAT 1 GGG 1 GGA 1 CAT 1 TGC 1 TAA 1 GCC 1 CCA 1 GTT 1 TGG 1 ATG 3 AAT 11986 days ago
Perl script to split fasta sequence and create overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "1986 days ago
Perl script to run in parellel !
...kManager; use Bio::SeqIO; my ($sequence_data_ref) = parse_genome_files($ARGV[0]); my %genome=%{$sequence_data_ref}; my $n_processes...s { my $file=shift; my (%sequence_data); my $file_content...nfo->length; my $GCcount = $sequence =~ tr/GC|gc//; my $GCc...1701 days ago
Perl subroutine to creating kmer !
sub k_mers { my ($sequence, $k) = @_; my $len = length($sequence); my @result = (); for (my $i = 0; $i1581 days ago
Bash script to download SRA file !
#We can use the sratoolkit to directly pull the sequence data (in paired FASTQ format) from the archive. fastq-dump is in the SRA toolkit. It allows directly downloading data from a pa...1573 days ago
Pack a perl program with their dependencies on Ubuntu !
...lyzingcodonusage perl script analyzing codon usage in an input sequence to evaluate how efficiently i...of plant and animal genomes, enabling new insights into evolution and sequence... Latest groups Bioinform...1525 days ago
Python script to check sequence length in multifasta file
#!/usr/bin/python from Bio import SeqIO import sys cmdargs = str(sys.argv) for seq_record in SeqIO.parse(str(sys.argv[1]), "fasta"): output_line = '%s\t%i' % \ (seq_record.id, len(seq_record)) print(output_line)1230 days ago
Onliner to split the multifasta to singlefasta files !
#Split the multifasta to singlefasta # Multi fasta #Single fasta awk '$0 ~ "^>" { match($1, /^>([^:]+)/, id); filename=id[1]} {print >> filename".fa"}' sequence.fasta1415 days ago
1416 days ago