2146 days ago
Implementation of biological random mutation with Perl
#!/usr/bin/perl -w use strict; use warnings; #sequence for a better recognition my $DNA="AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ n"; my $I; m...2903 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::Dumper; # individuals in the population my $popsize = 1024; # a good starting point...2374 days ago
Perl script to find coding regions in DNA sequences
#!/usr/bin/perl -w use strict; # if the number of input arguments is lower than 2 # return a message showing the error if (scalar(@ARGV) < 2) { print "dnaloglkh.pl co...2157 days ago
2077 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s/A/T/g; $...2045 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail -------------------------------------------------------- /usr/share/Modules/modulefiles -------------------------------------------------------...2036 days ago
2036 days ago
Setting up falconUnzip conda environments for genome assembly !
➜ Analysis_Results conda create -n denovo_asm Solving environment: done ## Package Plan ## environment location: /home/urbe/anaconda3/envs/denovo_asm Proceed ([y]/n)?...1992 days ago
Bash commandline to install Anaconda !
#The line begins with $ are the commands $ mkdir tmp $ cd tmp/ $ curl -O https://repo.anaconda.com/archive/Anaconda3-2019.03-Linux-x86_64.sh % Total % Received % Xfe...1557 days ago