Results for "real-time"
Bio-Scripts
# To follow these instructions, we'll assume your system admins have already installed these essentials: # Debian/Ubuntu system admins should run: sudo apt-get install...2153 days ago
Implementation of biological random mutation with Perl
#!/usr/bin/perl -w use strict; use warnings; #sequence for a better recognition my $DNA="AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ n";...2910 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::Dumper; # individuals in the population my $popsize = 1024; # a good st...2380 days ago
Perl script to find coding regions in DNA sequences
#!/usr/bin/perl -w use strict; # if the number of input arguments is lower than 2 # return a message showing the error if (scalar(@ARGV) < 2) { print "dna...2163 days ago
- ➜ upgrade_oh_my_zsh Updating Oh My Zsh remote: Counting objects: 484, done. remote: Compressing objects: 100% (243/243), done. remote: Total 484 (delta 290), reused...
2083 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2051 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail -------------------------------------------------------- /usr/share/Modules/modulefiles -------------------------------------------...2043 days ago
- (denovo_asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001/git-sym.git fatal: destination path 'git-sym' already exists and is not an empty directory. (d...
2042 days ago
Setting up falconUnzip conda environments for genome assembly !
➜ Analysis_Results conda create -n denovo_asm Solving environment: done ## Package Plan ## environment location: /home/urbe/anaconda3/envs/denovo_asm Proc...1998 days ago
Bash commandline to install Anaconda !
#The line begins with $ are the commands $ mkdir tmp $ cd tmp/ $ curl -O https://repo.anaconda.com/archive/Anaconda3-2019.03-Linux-x86_64.sh % Total % Re...1564 days ago
