Results for "Study"
Users
About me: I am trained bioinformatician and currently working as a research associate. My research project is to study adaptive metabolic pathway in humans.1796 days ago
- Interests: study the various software (Bioinformatics)
3396 days ago
- +5 more Users
Blogs
Five unique traits of effective computational biologist
...sting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand...3943 days ago
Tools to detect synteny blocks regions among multiple genomes
...ents both within and between species. It is intended to help scientists study and analyze synteny, homologo...other conserved elements between sequences. This software is useful in studying genome duplication and evo...2603 days ago
- +18 more Blogs
Bookmarks
Swabs to Genomes: A Comprehensive Workflow
...nce with bioinformatics can pose a significant barrier to entry for many who may be interested in microbial genomics. The objective of the present study was to design, test, troubles...3549 days ago
Junk part of the human genome unlocked
...Non-Coding Half of Human Genome with Novel DNA Sequencing Technique http://www.science.tamu.edu/news/story.php?story_ID=1282#.VDbBQ_mSyyA "this study stated that differences in th...3489 days ago
- +35 more Bookmarks
Files
- Basics concepts of Probability: The Study of Randomness Biostatistics is the application of statistics to a wide range of topics in biology. The science of biostatistics encomp...
2523 days ago
Discussion topics
Which are the best statistical programming languages to study for a bioinformatician?
In Bio-informatics based genome sequencing and predicting metabolic pathways research jobs I used Matlab, SAS, SPSS, R and several Bioconductor packages...3945 days ago
- Like in case of plant genomes where nature of genome is too complex and huge in size to accomplish complete de novo assembly by current sequencing technology. What would be alternate solution? Can we live in reference free world?
3938 days ago
- +1 more Discussion topics
Pages
- ...00 issue of the MIT Technology Review How to become a bioinformatics expert , including a listing ofEuropean opportunities to study bioinformatics. Compiled by t...
3914 days ago
Introduction to Bioinformatics
Bioinformatics (Genomics) Biocomputing in a Nutshell. Biologist's Guide to Internet Resources Computational Molecular Biology Course Course on Bioinformatics EM...3914 days ago
- +1 more Pages
Top-level pages
Phylogenetic for Bioinformatics
...s organisms. Not until recent decades, however, has it been possible to isolate and identify these molecular structures. phylogenetics is the study of evolutionary relatedness a...3939 days ago
- Genomics is the study of the genomes of organisms. The fi...are microarrays and bioinformatics. Study of the full set of proteins i...ateriomics, which is defined as the study of the material properties of...A Comparative Genomics Resource to Study Gene and Genome Evolution in...
3935 days ago
- +13 more Top-level pages
Wire posts
News
Vaccination can be dangerous sometimes !!!
...w area of discussion, and may give some vaccine developers pause. The study/research recently published i...t made H1N1 more efficient at infecting pigs and causing disease. This study suggests a role for fusion-en...3888 days ago
- ...del data set in diverse sorghum genotypes. In addition to providing a broad sample of the diversity in S. bicolor, the genotypes included in this study are known to display agronomi...
3891 days ago
- +18 more News
Opportunity posts
System Biologist at Millennium Software productions India Private Limited
...ytosolve.com Post - System Biologist Job Description: Role of system biology is to design quantitative models of bimolecular networks and to study interactions between the comp...3922 days ago
Senior Bioinformatics Programmer and SRF at BIOTECH PARK Lucknow
...b) Job Requirement Development of databases in multi user environment and application softwares, maintenance of website, Drug designing and QSAR study etc. c) Desirable Knowledg...3901 days ago
- +39 more Opportunity posts
ResearchLabs posts
- ...says, quantitative image analysis and cytosim, a computer simulation to study cellular architecture from a...lecular motors. In the past, we combined simulations and experiments to study microtubule self-organization...
3942 days ago
- The Bioinformatics group at Boku University has two main areas of interest, underpinning a common goal, the study of complex systems in living organisms. To overcome the engineered r...
3941 days ago
- +22 more ResearchLabs posts
Fun
Perl Poem: Parse it in both Perl and English!
...in (you, me),connect (us,together), tell me. do something if distressed; @dawn, dance;@evening, sing;read (books,$poems,stories) until peaceful;study if able; write me if-you-ple...3912 days ago
What a bioinformatician always dream for ???
...). Laptops with broadband connections. Licence to almost all genomics and proteomics servers. All eBooks of bioinformatics. Ready passport and Study visa....3838 days ago
Video
Computer Theory & Genetics: George Chao at TEDxUMNSalon
George Chao is an undergraduate senior studying Genetics and Computer Science at the University of Minnesot...steadily developed a fascination with the field of bioinformatics, the study of using computational techni...3909 days ago
- This is a promo video for the brand new cross-boarder branch of study - BIOINFORMATICS. It´s a co-operation between Johannes Kepler University in Linz (Austria) and University of Sou...
3896 days ago
- +9 more Video
Bio-Scripts
- ...ys in sample_links. extract them to a list we can use below SAMPLES=sample_links.keys() # download yeast rna-seq data from Schurch et al, 2016 study rule download_all: inpu...
1509 days ago
Polls
Which of the followings are the best place to study Bioinformatics ?
...and other 'omics' techniques. Bioinformatics provides the tools to analyse and exploit such data sets.Can you please suggest me the best place to study bioinformatics ( Grad/PostGra...3409 days ago
Tryst
Tryst with a Bioinformatician # Dr Altan Kara
...ans? Bioinformatics is not all about scripting and researchers who study in this field should never ex...ner research with scientists all around the world. As a result, while I studying in this field I can intera...2355 days ago
Groups
Bioinformatics as a business, not to be confused with bioinformatics as a field of study, is at an interesting crossroads. As an academic branch of learning, bioinformatics remains m...3946 days ago
...observational studies3) explaining the biological effects of the diet4) characterizing a specific genotype or phenotype Pipeline of Metabolomics study: http://www.nutrigenomics.bi...3699 days ago
- +2 more Groups
Tags
- Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3262 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3245 days ago
- +6 more Tags
Comments
- ...r bioinformatics research. The choice of the simulator depends on the specific research question and the type of sequencing technology used in the study....
408 days ago
Comment on "Genome in a Bottle (GIAB) Consortium"
Benchmark (or "High-confidence") variant calls and regions:We developed an integration pipeline to utilize sequencing data generated by multiple technologies to genera...1553 days ago
- +13 more Comments
