1796 days ago
3396 days ago
Five unique traits of effective computational biologist
...sting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand...3943 days ago
Tools to detect synteny blocks regions among multiple genomes
...ents both within and between species. It is intended to help scientists study and analyze synteny, homologo...other conserved elements between sequences. This software is useful in studying genome duplication and evo...2603 days ago
Swabs to Genomes: A Comprehensive Workflow
...nce with bioinformatics can pose a significant barrier to entry for many who may be interested in microbial genomics. The objective of the present study was to design, test, troubles...3549 days ago
Junk part of the human genome unlocked
...Non-Coding Half of Human Genome with Novel DNA Sequencing Technique http://www.science.tamu.edu/news/story.php?story_ID=1282#.VDbBQ_mSyyA "this study stated that differences in th...3489 days ago
2523 days ago
Which are the best statistical programming languages to study for a bioinformatician?
In Bio-informatics based genome sequencing and predicting metabolic pathways research jobs I used Matlab, SAS, SPSS, R and several Bioconductor packages...3945 days ago
3938 days ago
3914 days ago
Introduction to Bioinformatics
Bioinformatics (Genomics) Biocomputing in a Nutshell. Biologist's Guide to Internet Resources Computational Molecular Biology Course Course on Bioinformatics EM...3914 days ago
Phylogenetic for Bioinformatics
...s organisms. Not until recent decades, however, has it been possible to isolate and identify these molecular structures. phylogenetics is the study of evolutionary relatedness a...3939 days ago
3935 days ago
Vaccination can be dangerous sometimes !!!
...w area of discussion, and may give some vaccine developers pause. The study/research recently published i...t made H1N1 more efficient at infecting pigs and causing disease. This study suggests a role for fusion-en...3888 days ago
3891 days ago
System Biologist at Millennium Software productions India Private Limited
...ytosolve.com Post - System Biologist Job Description: Role of system biology is to design quantitative models of bimolecular networks and to study interactions between the comp...3922 days ago
Senior Bioinformatics Programmer and SRF at BIOTECH PARK Lucknow
...b) Job Requirement Development of databases in multi user environment and application softwares, maintenance of website, Drug designing and QSAR study etc. c) Desirable Knowledg...3901 days ago
3942 days ago
3941 days ago
Perl Poem: Parse it in both Perl and English!
...in (you, me),connect (us,together), tell me. do something if distressed; @dawn, dance;@evening, sing;read (books,$poems,stories) until peaceful;study if able; write me if-you-ple...3912 days ago
What a bioinformatician always dream for ???
...). Laptops with broadband connections. Licence to almost all genomics and proteomics servers. All eBooks of bioinformatics. Ready passport and Study visa....3838 days ago
Computer Theory & Genetics: George Chao at TEDxUMNSalon
George Chao is an undergraduate senior studying Genetics and Computer Science at the University of Minnesot...steadily developed a fascination with the field of bioinformatics, the study of using computational techni...3909 days ago
3896 days ago
1509 days ago
Which of the followings are the best place to study Bioinformatics ?
...and other 'omics' techniques. Bioinformatics provides the tools to analyse and exploit such data sets.Can you please suggest me the best place to study bioinformatics ( Grad/PostGra...3409 days ago
Tryst with a Bioinformatician # Dr Altan Kara
...ans? Bioinformatics is not all about scripting and researchers who study in this field should never ex...ner research with scientists all around the world. As a result, while I studying in this field I can intera...2355 days ago
3946 days ago
3699 days ago
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3262 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3245 days ago
408 days ago
Comment on "Genome in a Bottle (GIAB) Consortium"
Benchmark (or "High-confidence") variant calls and regions:We developed an integration pipeline to utilize sequencing data generated by multiple technologies to genera...1553 days ago