Hi Alok,
You can try following Perl script on ur dataset. It will extract the numeric values and seperate it's chromosome, start and end coordinates with tabs in outFile.
usage : perl extractNumber.pl infileName > outFile
use strict;use...
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA
> chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one...
Centralized Bioinformatics Core Facilities provide shared resources for the computational and IT requirements of the investigators in their department or institution. As such, they must be able to effectively react to new types of experimental...