BOL

Hi Alok, You can try following Perl script on ur dataset. It will extract the numeric values and seperate it's chromosome, start and end coordinates with tabs in outFile. usage : perl extractNumber.pl infileName > outFile use strict;use...

I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one...

http://www.eurekalert.org/pub_releases/2014-05/bidm-bah050514.php

perl -nle '$count += () = /XY[0-9]+/g; END {print $count}' inputfile #Count #Perl #Perloneliner

Webinar http://webinars.sciencemag.org/webinar/archive/importance-bioinformatics-ngs #NGS #Webinar

Centralized Bioinformatics Core Facilities provide shared resources for the computational and IT requirements of the investigators in their department or institution. As such, they must be able to effectively react to new types of experimental...

http://genomemag.com/ #gen #omics

Hi Ruchira,           I Think There is Different software using Different Algorithm that's why something result look like different.But u can use GENESCAN. GENESCAN gives accurate result and also used world wide gene...